Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-22.50 kcal/mol
Antiterminator:    Distance from promoter:130 nt. Size=29 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttttca-tatgat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttcatttttcagattatcgtgtatgatgagaaagtattgaaaattaaatcagtgataaactaggggtgcctaacgtatgcgtaggctgagagagaagc
gcgtaaacttcttaaccctttggacctgatctggctcgtaccagcgtagggaagttaacggctttacataatgatgtctttatgagccaggtccttattt
ttttatggacctggctctttttattttggcatacgctggccatatctcgtccttgtcacgtacaggggggcaacaaaggttATG

    thiC


Gene: thiC     GI: 30265254     BI number: BA5463     GOG: COG0422     Description: thiamine biosynthesis protein Thi



           tt
 tg       t  t
a  t      t  t
g  c       at
t  t       ta
 at       t  t
 at        cg
 ta        cg
 at        ta
 cg        gc
a  |       gc
t  |       at
t  |       cg
 ta        cg
 cg        gc
 gc        at
 gc        gc
            tttttattttggcatacgctggccatatctcgtccttgtcacgtacaggggggcaacaaaggttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here

    ..................................................................................................................