                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:146 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-23.20 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=47 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taaaat. It has a score value of 97.72 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacattaggaaattattgctataaaatcaacggtaattgcatagtcttatcaagaaaaggtggagggacaggcccgatgaaaccttggcaacagccgt
ataacggaattgtgccaaatcctgcaggtaataaatcctgagagataagaaagagcctttagagcgtgttttcaaactgctcctttcttgttttcaggaa
aggggcagttttttattttgtataaaagaaaggagaatgagaaATG

    metA Gene: BA5656     GI: 30265427     BI number: BA5656     GOG: COG2873     Description: O-acetylhomoserine/O-acetylserine sulfhydrylas tc t  a ta ta gc t  | gt cg gc at gc a  |       tt t  |      t  t t  |       gc t  |       ta c  |       tg c  |       cg g  |       ta a  |       ta gc        ta at        cg at        cg at        tg gc        cg at        gc at        ta tg        cg at        at             tttttattttgtataaaagaaaggagaatgagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2873 O-acetylhomoserine sulfhydrylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:147 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.50 kcal/mol Antiterminator:    Distance from promoter:115 nt. Size=47 nt.     Delta G=-11.90 kcal/mol Anti-antiterminator:    Distance from promoter:85 nt.    Size=76 nt.     Delta G=-12.15 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaca-taaaat. It has a score value of 97.72 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacattaggaaattattgctataaaatcaacggtaattgcatagtcttatcaagaaaaggtggagggacaggcccgatgaaaccttggcaacagccgt ataacggaattgtgccaaatcctgcaggtaataaatcctgagagataagaaagagcctttagagcgtgttttcaaactgctcctttcttgttttcaggaa aggggcagttttttattttgtataaaagaaaggagaatgagaaATG     metA Gene: BA5656     GI: 30265427     BI number: BA5656     GOG: COG2873     Description: O-acetylhomoserine/O-acetylserine sulfhydrylas ag a  a a  g g  c ac at tt at g  | aa gg |  a ag gc        tc tg       t  a c  t       ta c  g       ta t  t       gc a  t      t  | a  t       gt a  t       cg t  c       gc a  a       at a         gc t  |      a  | g  |      t  |       tt g       t  |      t  t a       t  |       gc c        c  |       ta g       c  |       tg t       g  |       cg c       a  |       ta |         gc        ta c         at        ta t        at        cg a        at        cg a        gc        tg |         at        cg a        at        gc c        tg        ta c        at        cg                         ttttttattttgtataaaagaaaggagaatgagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2873 O-acetylhomoserine sulfhydrylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................