                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attaactataatttataagactgtctttaacagatattcctcagggaggtgtcatataATGAAAAGAACTTACCAACCAAAT
AAACGTAAGCGCAGCAAAGTACATGGTTTCCGCAGCCGTATGAGCACAGCAAACGGAC
GTAAAGTGCTAGCAGCTCGTCGTCGTAAAGGAAGAAAAGTATTATCTGCGTAGaccactga
tcgttcagtggtctttttttctaataatagtgaatttccgctgatgaactacaggagtgtcaattgatATGAAGAAAAAACATCGTA
TAAAAAAGAATGATG

   ق --- spoIIIJ --- jag Gene: rnpA     GI: 30265505     BI number: BA5737     GOG: COG0594     Description: ribonuclease P protein component Gene: spoIIIJ-2     GI: 30265504     BI number: BA5736     GOG: COG0706     Description: stage III sporulation protein J Gene: jag     GI: 30265503     BI number: BA5735     GOG: COG1847     Description: jag protei            AG GA       A  T G  C      A  A CG        AT AT        GT |  A      A  A |  A       AT |  A       GC A  G       GT AT       A  G CG       A  C GC       A  G       cg AT       T  T      t  t |  A      G  A       at |  G       CG        gc C  C       Ta        ta A  A       Gc        cg CG       C  c       at GC        Ta        cg AT        Gc        cg GC       |  t       at TG        Cg        Gc AT        Ta        At                         ttttttctaataatagtgaatttccgctgatgaactacaggagtgtcaattgatATGAAGAAAAAACATCGTATAAAAAAGAATGATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0594 RNase P protein component ... can be seen here [U] COG0706 Preprotein translocase subunit YidC ... can be seen here [R] COG1847 Predicted RNA-binding protein ... can be seen here     ..................................................................................................................