Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -7.99 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGTAACAAATTTAAAACCTGTAAAATTACGCGGTGAATTATCGCAAGGTATGATTT
TAGCGGGTGAAGAGAATGGTGTATTGTCATTAGCATCTATTGACCAAAATATACCAAA
TGGTACAAAAATCAAGTAAttaagacaagaaaagagatgtttcacgtgtaacatgtgtgaagcgtcttttttctttttacactctc
atttttgcattaagattgtagtattgttatcgttaagttatgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattAT
G

    GBAA0037


Gene: GBAA0037     GI: 47525292     BI number: GBAA0037     GOG: COG0084     Description: deoxyribonuclease, TatD famil


           AA
          A  T
           CG
           CG
           AT
           TA
          A  C
          T  A
          A  A
          A  A
          A  A
          A  A
          C  |
          C  |
           AT
           GC
           TA
           TA
          |  G
          |  T
          |  A
          |  A
  A       |  t
C  T      |  t
 GC       |  a
 AT       |  a
 TA       |  g        a
T  T      |  a      a  c
 AT       |  c       ta
 CG       |  a       gt
 TA       |  a      t  g
 GC       |  g      g  t
|  C      |  a       cg
|  A      |  a       at
|  A      |  a       cg
 TA       |  a       ta
 TA       A  g       ta
 AT        Ta        tg
 TA        Cg        gc
 GT        Ta        tg
 TA        At        at
 GC        Cg        gc
 GC        Gt        at
 TA        At        gt
                        ttttctttttacactctcatttttgcattaagattgtagtattgttatcgttaagttatgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0084 Mg-dependent DNase ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:43 nt.    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.80 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=68 nt.     Delta G= -7.99 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCA-CAAAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCATTAGCATCTATTGACCAAAATATACCAAATGGTACAAAAATCAAGTAAttaaga
caagaaaagagatgtttcacgtgtaacatgtgtgaagcgtcttttttctttttacactctcatttttgcattaagattgtagtattgttatcgttaagtt
atgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattATG

    GBAA0037


Gene: GBAA0037     GI: 47525292     BI number: GBAA0037     GOG: COG0084     Description: deoxyribonuclease, TatD famil


 ga
a  a
 aa
 ca
 ag
 ga
a  g
a  a
t  t
t  g
A  t
A  t
T  |
G  |
 At
 Ac
 Ca
 Tc
|  g
|  t
|  g
|  t
|  a
|  a
|  c
|  a
|
|
|          a
|        a  c
|         ta
|         gt
|        t  g
|        g  t
|         cg
|         at
A         cg
 A        ta
 A        ta
 A        tg
 A        gc
 C        tg
 A        at
 T        gc
            ttttttctttttacactctcatttttgcattaagattgtagtattgttatcgttaagttatgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0084 Mg-dependent DNase ... can be seen here

    ..................................................................................................................