                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=77 nt.     Delta G= -7.61 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATTGCGAACTTAAAAGGAATTTCTTATGAAGAAGTAGCGGAAATAACAACAAAAAA
TGCAAAAGCTTTATTTGGTGTTGAATAAaagagtgggaggacccattctttttttatttttgtgaaaaaatagcaggag
tgacagaaaagataagattgaatgagtagatgttacaataaggagagagaacaaagttttggacattctattttttaaaatgtaagaatggggaaaataa
taatggaaaagtcgtcatttttttgttttactaagtagagacgaaacgagtgtggaggcaagcATG

    GBAA0038 --- ksgA Gene: GBAA0038     GI: 47525293     BI number: GBAA0038     GOG: COG1658     Description: primase-related protein Gene: ksgA     GI: 47525294     BI number: GBAA0039     GOG: COG0030     Description: dimethyladenosine transferas            gt           a  g            gg            ag           a  a            Ag            Ag           T  a            A            A            G            T           T            G            T            G            G            T           T           T           A           T           T           T   AA       C   A  A      G   CG       A   GC       A  | T  T      A  | AT       A  | AT       C  | A  A      G  |       gg AT       T  |      a  a AT       A  |       gc AT        A        gc CG        A        gc A  G       A        ta AT        A        gt CG        A        at AT        C        gc AT        A        at TG        A        at                         tttttatttttgtgaaaaaatagcaggagtgacagaaaagataagattgaatgagtagatgttacaataaggagagagaacaaagttttggacattctattttttaaaatgtaagaatggggaaaataataatggaaaagtcgtcatttttttgttttactaagtagagacgaaacgagtgtggaggcaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1658 Small primase-like proteins (Toprim domain) ... can be seen here [J] COG0030 Dimethyladenosine transferase (rRNA methylation) ... can be seen here     ..................................................................................................................