Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:131 nt.    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.80 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=45 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=54 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaaa-taaaat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgaaatatacaatttgaaccaaataataaaatagcaatttacttatccagagaggtagagggactggccctatgacacctcagcagcgggttctgtaat
aggaacaccgtgctaattccagcaagcaagtcttgaaagataagtgatgggcctttgtttattaagccttgatcttattttttaggatcaaggctttttg
tattctaaaaagagaaaagggagtaatggaaaaagtacgttcataaaacaaagtaaattcatgtgtttagggggttATG

    GBAA0185 --- GBAA0186 --- GBAA0187 --- GBAA0188 --- GBAA0189


Gene: GBAA0185     GI: 47525444     BI number: GBAA0185     GOG: COG0601     Description: oligopeptide ABC transporter, permease protein
Gene: GBAA0186     GI: 47525445     BI number: GBAA0186     GOG: COG1173     Description: oligopeptide ABC transporter, permease protein
Gene: GBAA0187     GI: 47525446     BI number: GBAA0187     GOG: COG0444     Description: oligopeptide ABC transporter, ATP-binding protein
Gene: GBAA0188     GI: 47525447     BI number: GBAA0188     GOG: COG4608     Description: oligopeptide ABC transporter, ATP-binding protein
Gene: GBAA0189     GI: 47525448     BI number: GBAA0189     GOG: COG4166     Description: oligopeptide ABC transporter, oligopeptide-binding protei


  a
a  g
c  t
 gc
 at
 at
 cg
g  a       tt
a  a      t  a
c  a      g  t
 cg       t  t
 ta        ta
t  t       ta
a  a      c  |
a  |       cg         t
 ta        gc       t  t
 cg        gc       t  t
 gt        gt        at
|  g      t  t       ta
 ta       a  g       tg
 gt       g  a       cg
 cg       t  t       ta
 cg        gc        at
a  g       at        gc
c  |       at        ta
a  |       ta        ta
a  |       at        cg
 gc        gt        cg
 gc        at        gc
 at        at        at
                        ttttgtattctaaaaagagaaaagggagtaatggaaaaagtacgttcataaaacaaagtaaattcatgtgtttagggggttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here
[EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here
[EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here
[E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here
[E] COG4166 ABC-type oligopeptide transport system, periplasmic component ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................