                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=56 nt.     Delta G= -5.29 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACATGAAACAGAAGATGAAAAATATATGTATAGCTGGATTGAAGAGGGATCATATACT
GTGAAATAAataaaaagaggcATGCTCAATAACGGAGCATGCCTCTTTTATGGAATCGACATG
TATAATAATACCAAAAAAAGTTATAGAAAGATATATAGAAAGGATGATCAAGATAATG
CGTATTCATAAgaatttctacttatttcgacaaagattaatgtggcaattttcagtttgaaaatttgtatttttctgattctatatataata
taattgttggggaactaaggggggaatttATG

    GBAA0244 Gene: GBAA0244     GI: 47525500     BI number: GBAA0244     GOG: COG0477     Description: major facilitator family transporte             A           T  C           A  T            TG            AT            CG            TA           A  A           G  A           G  T           G  A           A  A   G       G  a A  A      A  t A  G      A  a        A G  G      G  a      T  A TG       T  a      A  C TA       T  a      A  G AT       A  a       CG GC       G  g       TA G  A      G  a       CG T  |       Tg        GC C  |       Cg        TA G  |       Gc        AT AT       A  |       cG TA        TA        gC AT        AT        gC TA        TG        aT GC        GC        gC                         TTTTATGGAATCGACATGTATAATAATACCAAAAAAAGTTATAGAAAGATATATAGAAAGGATGATCAAGATAATGCGTATTCATAAgaatttctacttatttcgacaaagattaatgtggcaattttcagtttgaaaatttgtatttttctgattctatatataatataattgttggggaactaaggggggaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................