                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCATAACCCGAAGGTCGCAGGTTCAAATCCTGTCCCCGCAACCAaatGGTCCCGTG
GTGTAGTGGTTAACATGCCTGCCTGTCACGCAGGAGATCGCCGGTTCGACCCCGGTCG
GGACCGCCAttttatataaagaaaagaacgaaacatgttgtttcgtatttttttatttgttttaacaaaaaactaataaagacagtcaaactat
ccttaggaaaactcctaaggacttttttatatatttaaaacctgtataataaagagcagagaacattgtgagtaaagtaggtgaagtctGTG

    GBAA0258 --- GBAA0259 --- rimI --- gcP Gene: GBAA0258     GI: 47525517     BI number: GBAA0258     GOG: COG0802     Description: conserved hypothetical protein TIGR00150 Gene: GBAA0259     GI: 47525518     BI number: GBAA0259     GOG: COG1214     Description: conserved hypothetical protein Gene: rimI     GI: 47777794     BI number: GBAA0260     GOG: COG0456     Description: ribosomal-protein-alanine acetyltransferase Gene: gcP     GI: 47525520     BI number: GBAA0261     GOG: COG0533     Description: O-sialoglycoprotein endopeptidas             A           C  C aa       T  G A  t       GC CG        TA CG        CG AT        CG A  C      |  A C  C      |  G GC       G  A CG       T  T |  T      C  C CG        CG        CC CG        GC       C  G C  T      T  C       CG T  G      A  G       AT GT        CG        GC TA        AT       |  G CG        AT        CG |  T      |  C       TG CG        TG        TA TG        TA        GC AT        GC        GC AT        GC        CG                         CCAttttatataaagaaaagaacgaaacatgttgtttcgtatttttttatttgttttaacaaaaaactaataaagacagtcaaactatccttaggaaaactcctaaggacttttttatatatttaaaacctgtataataaagagcagagaacattgtgagtaaagtaggtgaagtctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0802 Predicted ATPase or kinase ... can be seen here [O] COG1214 Inactive homolog of metal-dependent proteases, putative molecular chaperone ... can be seen here [R] COG0456 Acetyltransferases ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here     ..................................................................................................................