                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=63 nt.     Delta G=-23.40 kcal/mol
Anti-antiterminator:    Distance from promoter:68 nt.    Size=59 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaaaatactttcaagagttaatatgagtatgtaattcaaacgaaaagtgaatattatgccgtcgtataatatcggggatatggcccgaaagtttc
tacctagctaccgtaaatggcttgactacgaggcgtttttataaaggtgaggggaatcttatctttattcatagaacgcttccatgtatatgcaatggaa
gccttttttatttttaataaataaaagagggctaggggaattacggcgagtaatcatataacgggggaaacgtaagATG

    GBAA0270 Gene: GBAA0270     GI: 47525529     BI number: GBAA0270     GOG: COG2252     Description: xanthine/uracil permease family protei            ga           g  a ct        gt a  a       gc gc        at tg        gt ta        ta cg        gt g  g       gc gc        at tg        at at        at at        ta at        at |  t      |  t |  t      |  c t  a      |  a g  t      t  t c  a       ta c  a       tg a  a       ta        ta tg        ta       a  t cg        gc        tg gt        cg        gc a  g       gc       |  a ta        gt        ta cg        at        at cg        gc        cg a  |      c  c       cg tg       a  a       ta cg       t  t       ta ta        cg        cg ta        at        gc                         cttttttatttttaataaataaaagagggctaggggaattacggcgagtaatcatataacgggggaaacgtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2252 Permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................