                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGGT-TACAAT. It has a score value of 60.91 and is shown in blue

TTGGGTTTATCTTCTATCCAATTACAATGGTAGTAAGTGGTCGACGTAAAGAGATTCA
TCCAATTATGTATGTTATGGGAGTTTTATTCGTACTATATTTCATTTATGTTCGTAAA
TAAaaggggtttttgaaaggtctagacttaaggggagtctagaccttttttgcgtcttcagaaaaacttaaggatttccgagcgtttttcttcagaag
ttttcctataatagaagttagggattaaaaaagtaatgggggagatattGTG

    GBAA0271 --- GBAA0272 Gene: GBAA0271     GI: 47525530     BI number: GBAA0271     GOG: COG0745     Description: DNA-binding response regulator Gene: GBAA0272     GI: 47525531     BI number: GBAA0272     GOG: COG0642     Description: sensor histidine kinas            g          a  g          a  g           tg           ta           cg           at           gc           at           ta           cg           ta           gc           gc           at             tttttgcgtcttcagaaaaacttaaggatttccgagcgtttttcttcagaagttttcctataatagaagttagggattaaaaaagtaatgggggagatattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................