                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=63 nt.     Delta G=-14.79 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTACTGTACACACAAGCTAACCGAATTAAAGTGCATTCACCAGACAAACTAATGAT
TAATTTAGATGGTGAATACGGTGGAGATGCACCGATGGAATTCGAAAATATATATCAT
TGTCTGGAACTATTTGTTCCTGAACATCAAGAGGATGCCCTGTAAaggcatcctttttattatatag
aggaattgtaaattggaagttagtttgattttcatggtatttttacaattcgtttattttatatccatactttattgatacactggaggagataagagac
gagaggtagggtgtgctATG

    GBAA0324 Gene: GBAA0324     GI: 47525590     BI number: GBAA0324     GOG: COG0546     Description: haloacid dehalogenase/epoxide hydrolase family protei GA A  T G  G GC TA GC GC CG |  A |  T |  G |  G |  A |  A |  T |  T        T |  C      A  T |  G      T  T |  A       CG |  A       AT |  A       AT |  A       GC |  T       GC |  A      |  T AT       |  G TA       |  A AT       |  A |  A      |  C        T AT       |  A      G  A GC       |  T      T  A TA       |  C      C  a GT       |  A       Cg G  T       TA        Cg T  G       CG        Gc AT        TA        Ta GC       G  G       At AT        TG        Gc TG        TA        Gc TG        AT        At TA        CG        Gt                         tttattatatagaggaattgtaaattggaagttagtttgattttcatggtatttttacaattcgtttattttatatccatactttattgatacactggaggagataagagacgagaggtagggtgtgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0546 Predicted phosphatases ... can be seen here     ..................................................................................................................