Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=79 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=43 nt.     Delta G= -3.77 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATA-TAAAGT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATATTGCTGCTATGGATTTTTCTAAAGTAGATGCATATAAAGAGGAGATTCAAAA
AGAGTTTGAACGAATTGCGATTAGTGTAACGGAAAAGAACAAGTAAaaaataaagaattttagcag
gctgtcgggaattttctgacagctattttagtatgtagtaagcttagtaatatatttgtcgaatttccaaggaaataatcaaaaaaatggagagggtatg
aaATG

    GBAA0363


Gene: GBAA0363     GI: 47525633     BI number: GBAA0363     GOG: COG3541     Description: conserved hypothetical protei


           CA
          A  A
          A  G
          G  T
          A  A
          A  A
          A  a
          A  a
          G  a
          G  a
          C  t
          A  a
          A  a
          T  a
          G  g
          T  a
          G  a
          A  t
          T  t
  A       T  t
A  A      A  t
A  A      G  a
 CG        Cg
 TA        Gc
 TG        Ta
 AT        Tg
 GT       |  g
 AT       |  c
G  G      |  t
G  A      A  g
A  A       At         t
G  C       Gc       a  t
A  G       Cg        at
A  A      A  g       gt
A  A      A  |       gc
T  T      G  |       gt
A  |       Tg        cg
T  |       Ta        ta
 AT        Ta        gc
 CG        Gt        ta
 GC        At        cg
 TG        Gt        gc
                        tattttagtatgtagtaagcttagtaatatatttgtcgaatttccaaggaaataatcaaaaaaatggagagggtatgaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3541 Predicted nucleotidyltransferase ... can be seen here

    ..................................................................................................................