Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:183 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.20 kcal/mol
Antiterminator:    Distance from promoter:165 nt. Size=31 nt.     Delta G= -8.51 kcal/mol
Anti-antiterminator:    Distance from promoter:167 nt.    Size=12 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgata-tataac. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaacgcc is shown in italic-bold style

atgatattcaacaaatttatttcgttataacgatgaaaaaggactagtacatgttcaacctttttagcagagagagaatccgtcaggctgaaagattctt
aaaaagacaacatggaacctacctttgcgttctgcatatgcagcgggaatttcccgttatcaaaaagagagcatgcgcaatttttgtgcatgaatcaggg
tggtaacgccggcaaagctcggtccctattttgggacgcgggcttttttgtattttctagaaggaggaagactgactATG

    proS


Gene: proS-1     GI: 47525667     BI number: GBAA0396     GOG: COG0442     Description: prolyl-tRNA synthetas


            a
          a  a
           cg
           gc
          |  t       tt
           gc       a  t
           cg       t  t
           cg        cg
           gt        cg
          c  |       cg
          a  |       ta
          a  |       gc
          t  |      |  g
          g  |       gc
 ta       g  |       cg
g  a      t  |       tg
 gc        gc        cg
 tg        gc        gc
 gc        gc        at
 gc        at        at
                        ttttgtattttctagaaggaggaagactgactATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0442 Prolyl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................