Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.00 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=40 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:    Distance from promoter:60 nt.    Size=32 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TATACC. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACAGCGGTAGTAGTAGGTGAACTATACCGTCATGCAGGTGAATGGAAGTTCAA
TGCAATCGGAAGTGGATTCCAAGGTGGATTAGCGTCTCTATGTAATAATTTCGGTTTA
GATGTAGAGTAAtagattgatatatccatcggtaaaacagatgtttactgatggatatattttttaagattaaaatatagaggtgaatata
aATG

    GBAA0401


Gene: GBAA0401     GI: 47525672     BI number: GBAA0401     GOG: COG2310     Description: tellurium resistance protei


            t
          A  a
          A  g       ga
           Ta       a  t
           Gt        cg
           At        at
 TC       |  g      a  |
T  G      G  a       at
 TG        At        at
 AT        Ta        ta
 AT        Gt        gc
T  T       Ta        gt
A  A       At        cg
A  G       Gc        ta
 TA       A  c       at
 GT       T  |       cg
 TG       T  |       cg
 AT        Ta        ta
 TA        Gt        at
 CG        Gc        ta
 TA        Cg        at
 CG        Tg        ta
                        ttttttaagattaaaatatagaggtgaatataaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG2310 Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 ... can be seen here

    ..................................................................................................................