                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.00 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=40 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:    Distance from promoter:60 nt.    Size=32 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TATACC. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACAGCGGTAGTAGTAGGTGAACTATACCGTCATGCAGGTGAATGGAAGTTCAA
TGCAATCGGAAGTGGATTCCAAGGTGGATTAGCGTCTCTATGTAATAATTTCGGTTTA
GATGTAGAGTAAtagattgatatatccatcggtaaaacagatgtttactgatggatatattttttaagattaaaatatagaggtgaatata
aATG

    GBAA0401 Gene: GBAA0401     GI: 47525672     BI number: GBAA0401     GOG: COG2310     Description: tellurium resistance protei             t           A  a           A  g       ga            Ta       a  t            Gt        cg            At        at TC       |  g      a  | T  G      G  a       at TG        At        at AT        Ta        ta AT        Gt        gc T  T       Ta        gt A  A       At        cg A  G       Gc        ta TA       A  c       at GT       T  |       cg TG       T  |       cg AT        Ta        ta TA        Gt        at CG        Gc        ta TA        Cg        at CG        Tg        ta                         ttttttaagattaaaatatagaggtgaatataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2310 Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 ... can be seen here     ..................................................................................................................