                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:86 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=66 nt.     Delta G=-18.80 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=40 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-CATAAT. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTTTTGTGAATTATACCGTCATAATGGACAGTGGAAGTTTAATGCAGTAGGAAG
CGGATTCCAAGGTGGTTTAGGTGCGCTTGTAAGAGCGTATGGCTTGGATGCATAAgaag
ggaaacgatattcgtttcctttttttgacctttctataaatctagcaaagaataggggatataggtaagATG

    GBAA0402 Gene: GBAA0402     GI: 47525673     BI number: GBAA0402     GOG: COG0861     Description: tellurium resistance protein, putativ            TA           G  A            TG            TA            CG            GC            CG            GT           |  A           |  T           |  G            TG            GC            GT AG        AT T  G       TG G  A       TG A  A       TA CG        GT GC       |  G TG        GC A  G       TA A  A       GT T  |      |  A T  |      |  A        a T  |      G  g      t  t G  |      A  a      a  t AT       A  a       gc AT        Cg        cg GC        Cg        at GC        Tg        at TA        Ta        at G  A      A  a       gc A  G      G  a       gc CG        Gc        gt AT        Cg        at                         tttttgacctttctataaatctagcaaagaataggggatataggtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here     ..................................................................................................................