Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:65 nt.    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.70 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=64 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGACA-AAACGT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGACATTTATGAGCATGTTATGAAACGTGAAACATTCAGCATTAGTGAAATGCAAGC
TATTACAGAAGAATTAGGTACATTAATTAAAAAGTAAaaaaagcctcgcttatgaggctcttttttatttcca
acaaattcatgacaactcttctctttccctcaaccaactgtaaaatattgtacaatagaagtagaacctcatcttagattttttctccatacatactact
cacaaataatagcaacactaccattgctaactgtttttactggaggtgcttacttATG

    GBAA0405


Gene: GBAA0405     GI: 47525676     BI number: GBAA0405     GOG: COG0474     Description: cation-transporting ATPase, E1-E2 famil


            A
          T  C
          G  A
           GT
           AT
           TA
           TA
  T        AT
A  G       AT
A  C      G  A
A  A      A  A
G  A      A  A
 TG       G  A
 GC       A  A
 AT        CG
 TA        AT
T  T       TA
A  T       TA
C  A      A  a
G  C      T  a
A  A      C  a       tt
 CG       G  a      c  a
 TA       A  a       gt
 TA       A  |       cg
A  G       Cg        ta
C  A       Gc        cg
A  A      T  c       cg
A  |      A  |       gc
 AT       A  |       at
 GT        At       a  c
 TA        Gc        at
G  G       Tg        at
 CG        Gc        at
 AT        At        At
                        ttatttccaacaaattcatgacaactcttctctttccctcaaccaactgtaaaatattgtacaatagaagtagaacctcatcttagattttttctccatacatactactcacaaataatagcaacactaccattgctaactgtttttactggaggtgcttacttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG0474 Cation transport ATPase ... can be seen here

    ..................................................................................................................