                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTATCCATTCGTACCGCTGCTTGCATTAGTATTAAATGTAACAGTAATTGTTGGTATG
GCCTTTATTCCAGAACAAAGAATGGCGTTATATTGTGGAATTCCATTTATGATTGTTT
GCTTACTGTTTTACCGTGCGACAAGAAATAAGGCACATAAAGTAGAACATATTGAAAA
GACAGATACAACAGAAGTAGACAGTTTATAAtattgagtaatttagagactgtaaaattgtaaacagtctctttttt
tgtgaaaataaagctggaaacatattatgtatgtaaagggggattagcgATG

    GBAA0493 Gene: GBAA0493     GI: 47525762     BI number: GBAA0493     GOG: COG0624     Description: acetylornitine deacetylase, putativ   a g  g t  t t  a       tt a  a      a  g t  t      a  t At       a  a At       a  a Ta        ta A  g       gc Ta        ta Tg        cg Ta        at Gc        gc At        at Cg        gc At        at             ttttttgtgaaaataaagctggaaacatattatgtatgtaaagggggattagcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here     ..................................................................................................................