                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:108 nt.    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=61 nt.     Delta G= -7.12 kcal/mol
Anti-antiterminator:    Distance from promoter:69 nt.    Size=19 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAAT-TAAAAA. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAATTGCTTGAATGGATTTAGTAAAAACGGAAGTGTGTATGTCGTTTTATTATCTA
ACATTCAAAATAATATTAAATCGTTTGGTAAAGTGAACAACGACATTTATACGATGTT
GCGAAATATTGAAGTGTAAgagactatccttttggatagtcttttttttgcttagaccatattgtttcgatgaaaaatgtatgtct
tacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG

    GBAA0503 --- GBAA0504 --- GBAA0505 Gene: GBAA0503     GI: 47525772     BI number: GBAA0503     GOG: -------     Description: hypothetical protein Gene: GBAA0504     GI: 47777825     BI number: GBAA0504     GOG: -------     Description: conserved hypothetical protein Gene: GBAA0505     GI: 47777826     BI number: GBAA0505     GOG: COG0463     Description: glycosyl transferase, group 2 family protei            CG           G  A            TA            TA            GT            TA            AT            GT            CG           A  |           T  |           A  |            TA            TA            TG            AT            CG            AT           G  A           C  A           A  g           A  a           C  g           A  |   T       A  |       tt A  A      G  |      t  t T  C       Ta        cg TG        Gc        cg TA        At        ta AT       A  a       at CG       A  t       ta AT       T  |       cg GT        Gc        at CG        Gc        gc                         ttttttttgcttagaccatattgtttcgatgaaaaatgtatgtcttacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:105 nt.    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.70 kcal/mol Antiterminator:    Distance from promoter:70 nt. Size=61 nt.     Delta G= -7.12 kcal/mol Anti-antiterminator:    Distance from promoter:71 nt.    Size=33 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TGGAAT-TAAAAA. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGAATTGCTTGAATGGATTTAGTAAAAACGGAAGTGTGTATGTCGTTTTATTATCTA ACATTCAAAATAATATTAAATCGTTTGGTAAAGTGAACAACGACATTTATACGATGTT GCGAAATATTGAAGTGTAAgagactatccttttggatagtcttttttttgcttagaccatattgtttcgatgaaaaatgtatgtct tacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG     GBAA0503 --- GBAA0504 --- GBAA0505 Gene: GBAA0503     GI: 47525772     BI number: GBAA0503     GOG: -------     Description: hypothetical protein Gene: GBAA0504     GI: 47777825     BI number: GBAA0504     GOG: -------     Description: conserved hypothetical protein Gene: GBAA0505     GI: 47777826     BI number: GBAA0505     GOG: COG0463     Description: glycosyl transferase, group 2 family protei            TA           G  A            Tg            Ga            Ag            Aa            Gc            Tt            Ta           A  |           T  |           A  |            At            Ac            Gc            Ct CG        Gt G  A       Tt TA       T  t TA       G   GT       T   TA       A         tt AT       G        t  t GT       C  |       cg CG       A  |       cg A  |      T  |       ta T  |       A        at A  |       T        ta TA        T        cg TA       T         at TG       A         gc AT       C  |       at CG        A        gt AT        G        At                         tttttgcttagaccatattgtttcgatgaaaaatgtatgtcttacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here     ..................................................................................................................