                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:41 nt.    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=37 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATT-AAAAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATTCAATCTTTTGAAACTGAAAAAATGATTTCAAATTTAGGATAAgatataccgctatctt
cagataaaaggtccttctttacatggaaataaagaagggctttttttattctcatttcctcgttttgcccgtaacctaagaagattaggagtatggtatt
cagtgtgaaaaatggagccttagcgctttagttttaaaatttcgacaaaaaagttataatagaaaaaaagtgaatgcagctcaaagggcatttgcagttg
aaagaagggagcatatATG

    GBAA0527 Gene: GBAA0527     GI: 47525796     BI number: GBAA0527     GOG: COG3557     Description: conserved hypothetical protei AT A  G A  A AT AT AT GC TA C  A A  A AT AT GT TA T  | T  | TG        tc        gg CG       t  a      t  a TA        cg       a  a AT        ta       c  a A  A       at        at C  A       ta        ta Tg       |  a       ta Ta       c  a       ta At       g  a       cg |  a       cg        ta |  t       cg        ta G  a       at        cg T  c      t  c       cg Gc       a  c       tg Tg       t  t       gc Gc        at        gt At        gc        at Ta        At        at At        At        at                         tttattctcatttcctcgttttgcccgtaacctaagaagattaggagtatggtattcagtgtgaaaaatggagccttagcgctttagttttaaaatttcgacaaaaaagttataatagaaaaaaagtgaatgcagctcaaagggcatttgcagttgaaagaagggagcatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG3557 Uncharacterized domain/protein associated with RNAses G and E ... can be seen here     ..................................................................................................................