Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=71 nt.     Delta G= -5.51 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACTGAAACAAGCATTTTATCTAGCATTGAACCACTTGTAGCAGCTATCGTTTCAAT
CGCTTGGCTGAATGAATCCTTTGGAGCCTATCAATTACTAGGCGGCCTATGTATCGTT
CTTTCTGTTATTTTCTTAACGATGCCGCAAAAAGAAAATGAAGCTACCTTTTCAACTG
AACAAATATAAaaaatgtcaaaagtggtcgtacaaaacttacgacctcttttgacgttttaaaggaattgtcccgctttctggcaaatacaa
ttacactaacaatcaaaattaggagtgtggcaccATG

    GBAA0580


Gene: GBAA0580     GI: 47525855     BI number: GBAA0580     GOG: -------     Description: lipoprotein, putativ


           AC
          A  T
           CG
           TA
           TA
          T  C
          T  A
          C  A
          C  A
          A  T
          T  A
          C  T
          G  A
          A  A
          A  a
          G  a
          T  a
          A  a
          A  t
 TG       A  g
A  C       At
 GC        Gc
 CG       A  a
|  C      A  a
|  A      A  a
A  A      A  a
A  A      A  |        a
 TA        Cg       a  a
 TA        Gt       a  c
 CG        Cg       c  t
 TA        Cg        at
 TA        Gt        ta
 TA       T  |       gc
 TA       A  |       cg
 AT        Gc        ta
 TG        Cg        gc
 TA        At        gc
                        tcttttgacgttttaaaggaattgtcccgctttctggcaaatacaattacactaacaatcaaaattaggagtgtggcaccATG


    ..................................................................................................................