                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:23 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:81 nt. Size=27 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:    Distance from promoter:47 nt.    Size=45 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-CATATT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATATAGAACAATCGATTCACATATTCGTAATATCCGCGATAAATTACGGAAAAA
AGGATTTCCAGTTGAAAATTACTTAGAAACTGTTTATAAGGTCGGATATAAATGGAAA
AGTGAATAAtcacttcggtcagtggaaactagtataccactgaccctttattatgaataaggtatggtgagaaaATG

    GBAA0584 Gene: GBAA0584     GI: 47525859     BI number: GBAA0584     GOG: COG0642     Description: sensor histidine kinas TC G  G G  G A  A AT TA AT TA TA TA                   a GT        TA       t  g TG       A  A      c  t CG        At       a  a A  A       Gc       a  t A  A       Ta       a  a A  |       Gc        gc G  |       At        gc A  |       At        ta TA       |  c       gc TA       A  g       at CG       A  g       cg AT        Gt        ta TG        Gc        gc TA        Ta        gc                         ctttattatgaataaggtatggtgagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................