                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -8.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATCTAACGCTAATTTCCAACTCGTATTTGTATATCCGAAAATAATACTTCCCCAAA
TACAAGTAATGACTGCAATGATCCCAACAAATAATCCAATCCATTTTGCTCGATTTGT
TTTTAATAACATgcagcgtttccccttcaatgtataatgatacgttgtaagtgtatttcaacttaattctcattgtcaacggaaatgagaa
ttattttcaaccgtatgtattgacaatctaaagataaaggcttaatatcatgcttgctattgaaaaaaattctcactatgtagggggtacataATG

    GBAA0615 Gene: GBAA0615     GI: 47525892     BI number: GBAA0615     GOG: COG0614     Description: iron compound ABC transporter, iron compound-binding protei            tt at       a  t a  g      t  c c  t      g  a t  a       ta t  t       gc c  a       at c  a       at c  t       ta cg       g  a       ac ta       t  t      a  g t  t      t  t       cg ta       g  c       ta gc       c  |      g  | cg       a  |       ta gt       t  |       ta at        at        at cg        gc        cg gt        ta        ta Ta        at        cg A  a       at        ta Cg        tg        ta At        at        at                         tattttcaaccgtatgtattgacaatctaaagataaaggcttaatatcatgcttgctattgaaaaaaattctcactatgtagggggtacataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here     ..................................................................................................................