Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -8.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATCTAACGCTAATTTCCAACTCGTATTTGTATATCCGAAAATAATACTTCCCCAAA
TACAAGTAATGACTGCAATGATCCCAACAAATAATCCAATCCATTTTGCTCGATTTGT
TTTTAATAACATgcagcgtttccccttcaatgtataatgatacgttgtaagtgtatttcaacttaattctcattgtcaacggaaatgagaa
ttattttcaaccgtatgtattgacaatctaaagataaaggcttaatatcatgcttgctattgaaaaaaattctcactatgtagggggtacataATG

    GBAA0615


Gene: GBAA0615     GI: 47525892     BI number: GBAA0615     GOG: COG0614     Description: iron compound ABC transporter, iron compound-binding protei


           tt
 at       a  t
a  g      t  c
c  t      g  a
t  a       ta
t  t       gc
c  a       at
c  a       at
c  t       ta
 cg       g  a       ac
 ta       t  t      a  g
t  t      t  t       cg
 ta       g  c       ta
 gc       c  |      g  |
 cg       a  |       ta
 gt       t  |       ta
 at        at        at
 cg        gc        cg
 gt        ta        ta
 Ta        at        cg
A  a       at        ta
 Cg        tg        ta
 At        at        at
                        tattttcaaccgtatgtattgacaatctaaagataaaggcttaatatcatgcttgctattgaaaaaaattctcactatgtagggggtacataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here

    ..................................................................................................................