                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-25.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-25.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttcattcaaaaaaacatgtagtatactaacttcaaaatcagaggagaaagggagcaaagaactatgcttacttatacaacaattgtagttacatttgc
acaaaaacatcatcatcatacgtaacccttgaaacctagcggaaaaattacgcgtaggtacaagggttattcccgttgtacctacgctttggcgaaagag
ccatgtaggtattttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaa
ATG

    GBAA0629 Gene: GBAA0629     GI: 47525908     BI number: GBAA0629     GOG: COG0531     Description: amino acid permease family protei   a t  t t  t gc gc gc |  g at at cg at ta gc                   t gc        aa       t  t at       a  g      t  t ta       g  a       at gc        cg        ta cg        gc        gt gc        gc        gc c  |       ta        at a  |      t  |       ta t  |      t  |       gc t  |      c  |       ta a  |       gt        at a  |       cg        cg a  |       at        cg at        ta        gc at        cg        at gt        cg        gc g  g       at        at cg        ta        at gc        gt        at                         ttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-16.10 kcal/mol Antiterminator: Size=36 nt.     Delta G=-24.20 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-22.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttttcattcaaaaaaacatgtagtatactaacttcaaaatcagaggagaaagggagcaaagaactatgcttacttatacaacaattgtagttacatttgc acaaaaacatcatcatcatacgtaacccttgaaacctagcggaaaaattacgcgtaggtacaagggttattcccgttgtacctacgctttggcgaaagag ccatgtaggtattttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaa ATG     GBAA0629 Gene: GBAA0629     GI: 47525908     BI number: GBAA0629     GOG: COG0531     Description: amino acid permease family protei   a a  a a  t a  t g  a gc cg gc         a        aa |  g      t  t      a  g at       t  t      g  a ta        gc        cg cg        gc        gc cg        gc        gc at       |  g       ta a  a       at       t  | a  |       at       t  | gc        cg       c  | ta        at        gt ta        ta        cg cg        gc        at cg        gc        ta cg        at        cg at        ta        cg at        gc        at ta        cg        ta gt        gc        gt                         tttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here     ..................................................................................................................