Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-25.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-25.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttcattcaaaaaaacatgtagtatactaacttcaaaatcagaggagaaagggagcaaagaactatgcttacttatacaacaattgtagttacatttgc
acaaaaacatcatcatcatacgtaacccttgaaacctagcggaaaaattacgcgtaggtacaagggttattcccgttgtacctacgctttggcgaaagag
ccatgtaggtattttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaa
ATG

    GBAA0629


Gene: GBAA0629     GI: 47525908     BI number: GBAA0629     GOG: COG0531     Description: amino acid permease family protei


  a
t  t
t  t
 gc
 gc
 gc
|  g
 at
 at
 cg
 at
 ta
 gc                   t
 gc        aa       t  t
 at       a  g      t  t
 ta       g  a       at
 gc        cg        ta
 cg        gc        gt
 gc        gc        gc
c  |       ta        at
a  |      t  |       ta
t  |      t  |       gc
t  |      c  |       ta
a  |       gt        at
a  |       cg        cg
a  |       at        cg
 at        ta        gc
 at        cg        at
 gt        cg        gc
g  g       at        at
 cg        ta        at
 gc        gt        at
                        ttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0531 Amino acid transporters ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-24.20 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-22.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttcattcaaaaaaacatgtagtatactaacttcaaaatcagaggagaaagggagcaaagaactatgcttacttatacaacaattgtagttacatttgc
acaaaaacatcatcatcatacgtaacccttgaaacctagcggaaaaattacgcgtaggtacaagggttattcccgttgtacctacgctttggcgaaagag
ccatgtaggtattttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaa
ATG

    GBAA0629


Gene: GBAA0629     GI: 47525908     BI number: GBAA0629     GOG: COG0531     Description: amino acid permease family protei


  a
a  a
a  t
a  t
g  a
 gc
 cg
 gc         a        aa
|  g      t  t      a  g
 at       t  t      g  a
 ta        gc        cg
 cg        gc        gc
 cg        gc        gc
 at       |  g       ta
a  a       at       t  |
a  |       at       t  |
 gc        cg       c  |
 ta        at        gt
 ta        ta        cg
 cg        gc        at
 cg        gc        ta
 cg        at        cg
 at        ta        cg
 at        gc        at
 ta        cg        ta
 gt        gc        gt
                        tttttatctacatggctctttttttattgccaaaaagctagtaaaaaatgatgtttaagcaaatcttactacaaaggagttaacaaaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0531 Amino acid transporters ... can be seen here

    ..................................................................................................................