                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCGATTTTATTGTTACAAAAACCTGCATTAGTTGCATTAAAGGATTATGAAAAGCA
GAAGAAAGAAGGAAAAGATCCAGTATTCGATCCAGGGCCATTAGGCATTAAAAATGCT
GATTTCTGGGAGCATGAATACGGAAAAGGTAAGAAAGAAGAAGTATCTTAAtggaatagaaa
tgaaaaagcaaagggaaaatccctttgctttttttatgagcaaaatgaagcaggcagttatttttttgcctatttttgaatataaaaagaatgtacatgc
tttgttaggggaaggggtgagtATG

    GBAA0639 --- GBAA0640 Gene: GBAA0639     GI: 47525918     BI number: GBAA0639     GOG: COG1126     Description: amino acid ABC transporter, ATP-binding protein Gene: GBAA0640     GI: 47525919     BI number: GBAA0640     GOG: COG0834     Description: amino acid ABC transporter, amino acid-binding protei   a         c a  a      g  a a  t      a  a gc       g  a gc        ta gc        at at        tg at        ta        tt at        ta       a  t cg        tg       t  t gc       t  c      t  t at        ta        gt at        tg        at at        cg        cg at        gc        gc at        ta        gc gt        tg        at                         atttttgaatataaaaagaatgtacatgctttgttaggggaaggggtgagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.90 kcal/mol                                                                         Nomenclature/Definitions TTGCGATTTTATTGTTACAAAAACCTGCATTAGTTGCATTAAAGGATTATGAAAAGCA GAAGAAAGAAGGAAAAGATCCAGTATTCGATCCAGGGCCATTAGGCATTAAAAATGCT GATTTCTGGGAGCATGAATACGGAAAAGGTAAGAAAGAAGAAGTATCTTAAtggaatagaaa tgaaaaagcaaagggaaaatccctttgctttttttatgagcaaaatgaagcaggcagttatttttttgcctatttttgaatataaaaagaatgtacatgc tttgttaggggaaggggtgagtATG     GBAA0639 --- GBAA0640 Gene: GBAA0639     GI: 47525918     BI number: GBAA0639     GOG: COG1126     Description: amino acid ABC transporter, ATP-binding protein Gene: GBAA0640     GI: 47525919     BI number: GBAA0640     GOG: COG0834     Description: amino acid ABC transporter, amino acid-binding protei            a          a  a          a  t           gc           gc           gc           at           at           at           cg           gc           at           at           at             ttttatgagcaaaatgaagcaggcagttatttttttgcctatttttgaatataaaaagaatgtacatgctttgttaggggaaggggtgagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................