Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:82 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=79 nt.     Delta G= -5.42 kcal/mol
Anti-antiterminator:    Distance from promoter:1 nt.    Size=52 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggta-taaaag. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggtattgatacactttttttgtaaaagaagaaatgtagtattgtctttaaagtttaatttatttacattgttacttggctatacacaaaagtaatata
ttcggcaataaaagagcgctattggatagtgctcttttttatgaatagaaaggagtgagttaaATG

    GBAA0673


Gene: GBAA0673     GI: 47525953     BI number: GBAA0673     GOG: -------     Description: conserved hypothetical protei


           ta
          a  c
          t  a
          c  c
          g  a
          g  a
           ta
           ta
           cg
           at
           ta
           ta
           gt
           ta
          |  t
          |  a
          |  t
 tt       t  t
t  a      a  c
g  a      c  g
 at       a  g
 at       t  c
 at        ta
 ta        ta
t  t       at
t  t       ta
c  t       ta
 ta        ta
 gc       a  a
 ta       a  |
t  t       tg         g
 at        ta       t  g
 tg        tg        ta
 gt        gc        at
 at       |  g       ta
 ta       |  c       cg
 gc       |  t       gt
t  t      a  a       cg
a  t       at        gc
a  g       at        at
a  g       tg        gc
 gc        tg        at
 at        ta        at
                        ttttatgaatagaaaggagtgagttaaATG


    ..................................................................................................................