Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAAAAG. It has a score value of 64.26 and is shown in blue

TTGAAGAAGGATTTGAAGCACTTGTAAAAGATAAAACACAAGTGAAAATTCTTGTTTC
ACCTAAATAAtatagaatagtaaaaagtagctcttttctagaaatagaagagggctactttttttctatacagaaaggtgatagactttcctg
taactacaggtattttgtttggaaggggaagtctaATG

    GBAA0676


Gene: GBAA0676     GI: 47525956     BI number: GBAA0676     GOG: COG1226     Description: conserved hypothetical protei


          aa
         g  a
          at
          ta
          cg
          ta
          ta
          tg
          ta
          cg
          tg
          cg
          gc
          at
          ta
          gc
          at
          at
          at
            ttttctatacagaaaggtgatagactttcctgtaactacaggtattttgtttggaaggggaagtctaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1226 Kef-type K+ transport systems, predicted NAD-binding component ... can be seen here

    ..................................................................................................................