                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.21 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCCCTGATAGCCCTGCCGAGTATTTAGATTATATTATTGCAAGTAAGGACCATGCG
AATCCGTCATTTATAGAGAATAAAGTATTACAACCGAAATCTCCACAGTGGACTGTTA
CATCATGGCTCAAAAAATATACATATAATGATTATTCTGATCATTATCCAGTCGAGGC
GACTATTTCTATGAAGTAGtcttaaaaagtttcttcttaataggaagaaacttttttattttgtagaggaaatttcaactttcttt
ccaatatgtataagacatattgaaaagaggagagaaaaatGTG

    GBAA0679 --- GBAA0680 Gene: GBAA0679     GI: 47525959     BI number: GBAA0679     GOG: COG3616     Description: conserved hypothetical protein Gene: GBAA0680     GI: 47525960     BI number: GBAA0680     GOG: COG0277     Description: oxidoreductase, FAD-bindin   A T  T CG TA TA TG AT TA CG At Gc         a |  t      a  t |  t      t  a |  a       tg |  a       cg |  a       ta |  a       ta |  a       cg Cg        ta Gt        ta Gt        ta At        gc Gc        at C  t       at T  t       at Gc        at At        at             tattttgtagaggaaatttcaactttctttccaatatgtataagacatattgaaaagaggagagaaaaatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3616 Predicted amino acid aldolase or racemase ... can be seen here [C] COG0277 FAD/FMN-containing dehydrogenases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.90 kcal/mol Antiterminator: Size=46 nt.     Delta G=-10.21 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTCCCTGATAGCCCTGCCGAGTATTTAGATTATATTATTGCAAGTAAGGACCATGCG AATCCGTCATTTATAGAGAATAAAGTATTACAACCGAAATCTCCACAGTGGACTGTTA CATCATGGCTCAAAAAATATACATATAATGATTATTCTGATCATTATCCAGTCGAGGC GACTATTTCTATGAAGTAGtcttaaaaagtttcttcttaataggaagaaacttttttattttgtagaggaaatttcaactttcttt ccaatatgtataagacatattgaaaagaggagagaaaaatGTG     GBAA0679 --- GBAA0680 Gene: GBAA0679     GI: 47525959     BI number: GBAA0679     GOG: COG3616     Description: conserved hypothetical protein Gene: GBAA0680     GI: 47525960     BI number: GBAA0680     GOG: COG0277     Description: oxidoreductase, FAD-bindin   A T  T CG TA TA TG AT TA CG At Gc |  t |  t |  a |  a |  a        a |  a      a  t |  a      t  a Cg        tg Gt        cg Gt        ta At        ta Gc        cg C  t       ta T  t       ta Gc        ta At        gc             ttttttattttgtagaggaaatttcaactttctttccaatatgtataagacatattgaaaagaggagagaaaaatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3616 Predicted amino acid aldolase or racemase ... can be seen here [C] COG0277 FAD/FMN-containing dehydrogenases ... can be seen here     ..................................................................................................................