Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

aaatttatatgtatgcgatgataaagaagagtacatattgaggcaatttcagagagcttgtggctggtgtgaacaagtaattgtacagtatggaatgggc
ttttgagctccaaaccgaaccgaaagtagtaggctttggcgttatatccaaacgttactatggattagagagatttcacagtagtgaaataattagggtg
gtaccgcggtccattcgtccctatagttttttgggatgaatgggcttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattactt
ATG

    trpS


Gene: trpS     GI: 47526452     BI number: GBAA1188     GOG: COG0180     Description: tryptophanyl-tRNA synthetas


 gt
a  a
 cg
 at
 cg
 ta
 ta
 ta
 at
g  a
a  a
g  |       gc         t
a  |      c  g      g  t
 gt        cg       a  t
 at        at       t  t
 ta       t  |      a  t
 tg        gc       t  t
a  g       gc        cg
g  |       ta        cg
g  |      |  t       cg
 tg       |  t       ta
 at       |  c       gt
 tg       |  g       cg
 cg       |  t       ta
 at        gc        ta
 ta        gc        at
t  c       gc        cg
 gc        at        cg
 cg        ta        tg
                        cttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattacttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.62 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

aaatttatatgtatgcgatgataaagaagagtacatattgaggcaatttcagagagcttgtggctggtgtgaacaagtaattgtacagtatggaatgggc
ttttgagctccaaaccgaaccgaaagtagtaggctttggcgttatatccaaacgttactatggattagagagatttcacagtagtgaaataattagggtg
gtaccgcggtccattcgtccctatagttttttgggatgaatgggcttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattactt
ATG

    trpS


Gene: trpS     GI: 47526452     BI number: GBAA1188     GOG: COG0180     Description: tryptophanyl-tRNA synthetas


 ta
t  t
g  a
c  t
 gc
 gc
 ta
 ta
 ta
c  c
g  g
 gt
 at
 ta
 gc
 at
 ta
 gt
a  |
a  |       gt
a  |      a  a
g  |       cg
c  |       at
c  |       cg
a  |       ta
a  |       ta
g  |       ta        gc
 cg        at       c  g
 cg       |  a       cg
a  a      |  a       at
 at       |  t      t  |
 at       g  t       gc
c  a      a  a       gc
 cg       g  g       ta
 ta       a  g      |  t
 cg       g  g      |  t
|  a       at       |  c
|  g       tg       |  g
|  a       tg       |  t
|  t       at        gc
 gt       |  a       gc
 at        gc        gc
 gc        gc        at
 ta        tg        ta
                        tagttttttgggatgaatgggcttttttgtttgctttctcttccctgtcacgcattcaattttaggaggaattacttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................