                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgaaatcgtttaagtaagaagagtacgtatattggagacgttacagagagccggggataggtgggagcccggtgcggtgctatatacggaatgggctta
cgagaggtatgctgaacaattattttcagtaggcaacccgggttccgccgttacaaggataaggtatatattttgtacctgaataaagcgggatgctttt
gcgtccaacatgaggtggtaccacggtaaatttatcgtcctctacatattttcgatatgtagaggacttttttatttttcaggatgaggtgaaaggcatg
ATG

    trpE --- pabA --- 2 --- trpD --- GBAA1251 --- trpF --- trpB Gene: trpE     GI: 47526514     BI number: GBAA1248     GOG: COG0147     Description: anthranilate synthase component I Gene: pabA-2     GI: 47526515     BI number: GBAA1249     GOG: COG0512     Description: para-aminobenzoate synthase glutamine amidotransferase, component II Gene: trpD     GI: 47526516     BI number: GBAA1250     GOG: COG0547     Description: anthranilate phosphoribosyltransferase Gene: GBAA1251     GI: 47526517     BI number: GBAA1251     GOG: COG0134     Description: indole-3-glycerol phosphate synthase Gene: trpF     GI: 47526518     BI number: GBAA1252     GOG: COG0135     Description: N-(5'phosphoribosyl)anthranilate isomerase Gene: trpB     GI: 47526519     BI number: GBAA1253     GOG: COG0133,COG1350     Description: tryptophan synthase, beta subunit Gene: trpA     GI: 47526520     BI number: GBAA1254     GOG: COG0159     Description: tryptophan synthase, alpha subuni tt t  t cg gc        at tg       a  t at        at gc        ta gc        gt g  a       gc         t c  a       cg       t  c g  c       at        tg a  a      c  |       ta a  t      c  |       at a  g      a  |       ta t  a      t  |       at a  g       gc        cg a  g       gc        at g  t      t  t       ta t  |       gc        cg cg        gt        ta cg       a  a       cg at        gc        cg ta        ta        ta gc        at        gc                         ttttttatttttcaggatgaggtgaaaggcatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [E] COG0547 Anthranilate phosphoribosyltransferase ... can be seen here [E] COG0134 Indole-3-glycerol phosphate synthase ... can be seen here [E] COG0135 Phosphoribosylanthranilate isomerase ... can be seen here [E] COG0133 Tryptophan synthase beta chain ... can be seen here [R] COG1350 Predicted alternative tryptophan synthase beta-subunit (paralog of TrpB) ... can be seen here [E] COG0159 Tryptophan synthase alpha chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.70 kcal/mol Antiterminator: Size=38 nt.     Delta G= -6.70 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-15.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atgaaatcgtttaagtaagaagagtacgtatattggagacgttacagagagccggggataggtgggagcccggtgcggtgctatatacggaatgggctta cgagaggtatgctgaacaattattttcagtaggcaacccgggttccgccgttacaaggataaggtatatattttgtacctgaataaagcgggatgctttt gcgtccaacatgaggtggtaccacggtaaatttatcgtcctctacatattttcgatatgtagaggacttttttatttttcaggatgaggtgaaaggcatg ATG     trpE --- pabA --- 2 --- trpD --- GBAA1251 --- trpF --- trpB Gene: trpE     GI: 47526514     BI number: GBAA1248     GOG: COG0147     Description: anthranilate synthase component I Gene: pabA-2     GI: 47526515     BI number: GBAA1249     GOG: COG0512     Description: para-aminobenzoate synthase glutamine amidotransferase, component II Gene: trpD     GI: 47526516     BI number: GBAA1250     GOG: COG0547     Description: anthranilate phosphoribosyltransferase Gene: GBAA1251     GI: 47526517     BI number: GBAA1251     GOG: COG0134     Description: indole-3-glycerol phosphate synthase Gene: trpF     GI: 47526518     BI number: GBAA1252     GOG: COG0135     Description: N-(5'phosphoribosyl)anthranilate isomerase Gene: trpB     GI: 47526519     BI number: GBAA1253     GOG: COG0133,COG1350     Description: tryptophan synthase, beta subunit Gene: trpA     GI: 47526520     BI number: GBAA1254     GOG: COG0159     Description: tryptophan synthase, alpha subuni tt t  t cg gc        gg tg       c  t at        aa gc        ca gc        ca g  a       at         t c  a       tt       t  c g  c       gt        tg a  a      g  |       ta a  t      t  |       at a  g      g  |       ta t  a      g  |       at a  g       aa        cg a  g       gt        at g  t      t  c       ta t  |       ag        cg cg        ct        ta cg       a  c       cg at        ac        cg ta        ct        ta gc        cc        gc                         ttttttatttttcaggatgaggtgaaaggcatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [E] COG0547 Anthranilate phosphoribosyltransferase ... can be seen here [E] COG0134 Indole-3-glycerol phosphate synthase ... can be seen here [E] COG0135 Phosphoribosylanthranilate isomerase ... can be seen here [E] COG0133 Tryptophan synthase beta chain ... can be seen here [R] COG1350 Predicted alternative tryptophan synthase beta-subunit (paralog of TrpB) ... can be seen here [E] COG0159 Tryptophan synthase alpha chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................