                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.80 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=46 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:    Distance from promoter:77 nt.    Size=43 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-taaaat. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaaaatcagaattgtgataaaatacaaatacaaagcttatcaagagaagcggagggaactggcccggcgaagctcggcaacctgcttatagaaagc
aaggtgctaaatccagcaaaatggaatccattttgaaagataaggtaaaatatattaccgaacagtcttttcgaaatgggaaagattttttttatgaata
aaaaggggggctgttcgcGTG

    GBAA1439 Gene: GBAA1439     GI: 47526714     BI number: GBAA1439     GOG: -------     Description: conserved hypothetical protei            ta           a  t           a  a   a        at a  t       at gc        ta gc        gc ta        gc at       |  g at       |  a at       |  a at       a  c cg       a  a g  a       tg        aa a  a       at       a  t c  a       gc       g  g cg       |  t       cg ta        at        tg at        at        ta a  a       at        ta a  a       gc        ta tg        tg        cg cg        ta        ta gt        ta        gt ta        ta        at                         ttttttatgaataaaaaggggggctgttcgcGTG                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................