Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-21.40 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=40 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=47 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGATA-TACAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGATATGAAATATGGTTCAATTACAATTGTTGTACAAGATGGAAAAGTCATTCAACT
AGAGAAAAGTGAAAAAGTACGTTTAAAGTAAaaagcgctgactagaaaaactagaggcggttttaacctatttcatt
aggttaaaaccgtctttttgcttttacagggggaaaaaacATG

    cysH --- sat --- cysC --- nirA --- GBAA1444


Gene: cysH     GI: 47526715     BI number: GBAA1440     GOG: COG0175,COG5270     Description: phosphoadenosine phosphosulfate reductase
Gene: sat     GI: 47526716     BI number: GBAA1441     GOG: COG2046     Description: sulfate adenylyltransferase
Gene: cysC     GI: 47526717     BI number: GBAA1442     GOG: COG0529     Description: adenylylsulfate kinase
Gene: nirA     GI: 47526718     BI number: GBAA1443     GOG: COG0155     Description: nitrite reductase
Gene: GBAA1444     GI: 47526719     BI number: GBAA1444     GOG: -------     Description: hypothetical protei


  T
T  A
T  A
G  A
 CG
 AT         a
 TA       a  a
G  A      a  a
A  a       gc        tc
A  a       at       t  a
A  a       ta       t  t
A  g       cg        at
A  |      a  a       ta
 Gc       g  |       cg
 Tg        tg        cg
 Gc        cg        at
 At        gc        at
A  g       cg        ta
A  a      g  g       ta
A  |       at        ta
G  |       at        ta
A  |       at        gc
 Gc        At        gc
 At       A  a       cg
 Ta        Ta        gt
 Cg        Gc        gc
                        tttttgcttttacagggggaaaaaacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here
[J] COG5270 PUA domain (predicted RNA-binding domain) ... can be seen here
[P] COG2046 ATP sulfurylase (sulfate adenylyltransferase) ... can be seen here
[P] COG0529 Adenylylsulfate kinase and related kinases ... can be seen here
[P] COG0155 Sulfite reductase, beta subunit (hemoprotein) ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................