Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtgagcccggtacgataaaatatacagaatgggcttgcgagaggtatgttgaacattgtagtaggcaacccgggttccgccgttaaaaggatagagtat
cggagtttttcctgtacttgaacaagtgggatttatcaatccaattgaggtggtaccacggtattaacattacatatatcgtcctctacatgcatatttg
cgtgtaggggacttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatg
ATG

    GBAA1448


Gene: GBAA1448     GI: 47526723     BI number: GBAA1448     GOG: COG0733     Description: sodium-dependent transporter, putativ


 at
t  c
 ta
 ta
 at
 gc
 gc         t
g  a      a  t
t  a      c  a
g  |      a  c
 at       a  a
 at       t  t       at
 cg        ta       t  t
a  a       at        at
a  g       ta        cg
g  g       gt        gc
t  t       gc        tg
 tg        cg        at
 cg        at        cg
 at       c  c       at
 ta       c  c       ta
 gc       a  t       cg
|  c      t  |       tg
|  a       gc        cg
t  c       gt        cg
 cg        ta        ta
 cg        gc        gc
                        ttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtgagcccggtacgataaaatatacagaatgggcttgcgagaggtatgttgaacattgtagtaggcaacccgggttccgccgttaaaaggatagagtat
cggagtttttcctgtacttgaacaagtgggatttatcaatccaattgaggtggtaccacggtattaacattacatatatcgtcctctacatgcatatttg
cgtgtaggggacttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatg
ATG

    GBAA1448


Gene: GBAA1448     GI: 47526723     BI number: GBAA1448     GOG: COG0733     Description: sodium-dependent transporter, putativ


 at
t  c
 ta
 ta
 at
 gc
 gc         a
g  a      c  t
t  a      a  t
g  |      a  a
 at       t  c
 at       t  a       at
 cg        at       t  t
a  a       ta        at
a  g       gt        cg
g  g       ga        gc
t  t       ct        tg
 tg        ac        at
 cg        cg        cg
 at       c  t       at
 ta       a  c       ta
 gc       t  c       cg
|  c      g  |       tg
|  a       gt        cg
t  c       tc        cg
 cg        gt        ta
 cg        ga        gc
                        ttttttattttctaaaggaggtgtgcgagtatgaaatgaaagtgtataattaataaaagtttaaatattcagaaaaggggaatttatgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................