Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:41 nt.    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-20.80 kcal/mol
Antiterminator:    Distance from promoter:21 nt. Size=37 nt.     Delta G= -6.91 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGAGA-TATAAG. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: TGGGTGGTACCGCG is shown in italic-bold style

TCGAGATATTTCATCTCCGTATTGTATAAGTGAGCAACCTCTGTTGCTAATTTGGGTG
GTACCGCGGAACCAAAGCCTTTCGTCCCAGTTTTTTGGGAAAGAAGGGCTTTTTTTGT
TGGCTTCTTTTCACAACATCCAAACATTTTAGGAGGAAACCACCATG

    asnA


Gene: asnA     GI: 47527094     BI number: GBAA1808     GOG: COG2502     Description: aspartate--ammonia ligas


 TC
C  T
 CG
 AT
 AT
 CG
 GC        AA
 AT       A  G
G  A      C  C       TT
 TA       C  C      T  T
 GT        AT        GT
 AT        AT        AT
 AT        GT        CG
 TG        GC        CG
A  G       CG        CG
T  G       GT        TA
 GT       C  |      |  A
 TG       C  |      G  A
 TG       A  |       CG
 AT       T  |       TA
|  A      G  |       TA
|  C      G  |       TG
|  C      T  |       CG
 TG        GC        CG
 GC        GC        GC
 CG        GC        AT
 CG        TA        AT
 TA        TG        AT
                        TTTTGTTGGCTTCTTTTCACAACATCCAAACATTTTAGGAGGAAACCACCATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG2502 Asparagine synthetase A ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here
    ..................................................................................................................