                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-10.11 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

atttacgtagggacgttttttatttaggtcttactttgttgtggcttcataactagggtggtaccgcgataatttatcgtccctacgtatttacgtaggg
acgttttttatttaggtcttacttttgttgtatcttcataactagggtggtaccgcgatatttttgtcgtccctacgtatttacgtaggggcgttttttt
attagtagggaggaagtgaacgtattagaaagaagtgtggatagaacaatataaatactgaattgtaagacagaaaaagataaagagaggagattaacaa
ATG

    GBAA1835 Gene: GBAA1835     GI: 47527126     BI number: GBAA1835     GOG: COG0733     Description: sodium-dependent transporte ct t  t a  c ta        tt gt       t  t ta        at ta        tg gc        at t  t       gc ta        cg tg        gt tg       c  | cg       c  | at       a  |       tt tg       t  |      a  t tg       g  |       ta c  t      g  |       gc ta       t  |       cg gc        gc        at gc        gc        ta a  g       gc        cg t  c       at        cg tg        ta        cg ta       |  c       tg at        cg        gc ta        at        cg                         tttttttattagtagggaggaagtgaacgtattagaaagaagtgtggatagaacaatataaatactgaattgtaagacagaaaaagataaagagaggagattaacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:189 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.70 kcal/mol Antiterminator: Size=37 nt.     Delta G= -8.41 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-14.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggtaccgcg is shown in italic-bold style atttacgtagggacgttttttatttaggtcttactttgttgtggcttcataactagggtggtaccgcgataatttatcgtccctacgtatttacgtaggg acgttttttatttaggtcttacttttgttgtatcttcataactagggtggtaccgcgatatttttgtcgtccctacgtatttacgtaggggcgttttttt attagtagggaggaagtgaacgtattagaaagaagtgtggatagaacaatataaatactgaattgtaagacagaaaaagataaagagaggagattaacaa ATG     GBAA1835 Gene: GBAA1835     GI: 47527126     BI number: GBAA1835     GOG: COG0733     Description: sodium-dependent transporte ct g  t gc ta gt         t ta       a  t ta        at gc        ta |  t       at ta        gc tg        cg tg        gt cg       c  | at       c  | tg       a  |       tt tg       t  |      a  t c  t      g  |       ta ta       g  |       gc gc       t  |       cg gc        gc        at a  g       gc        ta t  c       gc        cg tg        at        cg ta        ta        cg at       |  c       ta ta        cg        gc ta        at        cg                         ttttttatttaggtcttacttttgttgtatcttcataactagggtggtaccgcgatatttttgtcgtccctacgtatttacgtaggggcgtttttttattagtagggaggaagtgaacgtattagaaagaagtgtggatagaacaatataaatactgaattgtaagacagaaaaagataaagagaggagattaacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................