                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:50 nt.    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-23.30 kcal/mol
Antiterminator:    Distance from promoter:30 nt. Size=41 nt.     Delta G= -9.21 kcal/mol
Anti-antiterminator:    Distance from promoter:39 nt.    Size=10 nt.     Delta G= -1.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-gaactt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccacg is shown in italic-bold style

ttgacggaatcagccgttatctgaacttgagcaatctagggagaaatatgtctaggttggaacaagggtggaaccacgaaaacacattcgtccctttcct
agggatgggtgtgtttttttattactttgaaaggaggtgcagtaacatgaaacgatttgtacgtacggaaataaccaccacctgcatgattaaaaagcag
agcaaggtgattggtaaagataaataataaaattgtaggaggagattagaagATG

    hom --- 1 --- thrC Gene: hom-1     GI: 47527263     BI number: GBAA1968     GOG: COG0460     Description: homoserine dehydrogenase Gene: thrC     GI: 47527264     BI number: GBAA1969     GOG: COG0498     Description: threonine synthase Gene: thrB     GI: 47527265     BI number: GBAA1970     GOG: COG0083     Description: homoserine kinas            ca           a  c           a  a            at            at            gc         c            cg       t  c            at       t  t           c  |       ta           c  |       cg           a  |       cg           a  |       cg           g  |       ta           g  |       gt           t  |       cg            gc        tg            gc        tg            gc        at            at        cg           a  |       at aa       c  |       cg g  c       at        at gc        at        at ta        gc        at gc        gc        at                         tttattactttgaaaggaggtgcagtaacatgaaacgatttgtacgtacggaaataaccaccacctgcatgattaaaaagcagagcaaggtgattggtaaagataaataataaaattgtaggaggagattagaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0460 Homoserine dehydrogenase ... can be seen here [E] COG0498 Threonine synthase ... can be seen here [E] COG0083 Homoserine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................