                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:130 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAC-TAAAAT. It has a score value of 62.25 and is shown in blue

TTTAACGGTTTAGAAAGTGCGAAGATTAAAATTGACGCGATTTCTAATGTATTACAAA
TATTACCATTATATAACGAAGGAATAGGATGGTTAATCCCATCATGTATTGGCGGGAT
TCTCGGTTTCTTTTTCTATAAATCAAATGAATCAAGTGAACTACAAAAGAAAGGTGCT
TAGgcgcctttctttttttaaaggggatttttttgttttgtctaagtaataaatgaaaggagtgataaaATG

   ل --- csaA Gene: csaA     GI: 47527356     BI number: GBAA2064     GOG: COG0073     Description: chaperone CsaA Gene: GBAA2065     GI: 47527357     BI number: GBAA2065     GOG: NOG28973     Description: conserved hypothetical protei           TA          T  G           Cg           Gc           Tg           Gc           Gc           At           At           At           Gc           At           At             tttttaaaggggatttttttgttttgtctaagtaataaatgaaaggagtgataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0073 EMAP domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:130 nt.    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTAAC-TAAAAT. It has a score value of 62.25 and is shown in blue TTTAACGGTTTAGAAAGTGCGAAGATTAAAATTGACGCGATTTCTAATGTATTACAAA TATTACCATTATATAACGAAGGAATAGGATGGTTAATCCCATCATGTATTGGCGGGAT TCTCGGTTTCTTTTTCTATAAATCAAATGAATCAAGTGAACTACAAAAGAAAGGTGCT TAGgcgcctttctttttttaaaggggatttttttgttttgtctaagtaataaatgaaaggagtgataaaATG    ل --- csaA Gene: csaA     GI: 47527356     BI number: GBAA2064     GOG: COG0073     Description: chaperone CsaA Gene: GBAA2065     GI: 47527357     BI number: GBAA2065     GOG: NOG28973     Description: conserved hypothetical protei           TA          T  G           Cg           Gc           Tg           Gc           Gc           At           At           At           Gc           At           At             tttttaaaggggatttttttgttttgtctaagtaataaatgaaaggagtgataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0073 EMAP domain ... can be seen here     ..................................................................................................................