                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-12.71 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtatcgcg is shown in italic-bold style

aagtatacaaatctgaagacgagaaagggtaaaatagtgtactgttccccagagagccggtatgttgctgaaagccggtgtacagatgttatttgaaaat
catctccgaggagccgaggctgaaaataagtaagctcggacgggtgtctaccgttacaaggaacacgtatgatcgtacgttgctaagtgctattagtgaa
gaactaatagaattagggtggtatcgcgggtaaacccgtccctactttatagggacgggttttttgtgtgctttaaaacattcaaaaggagtgattgtag
ATG

    GBAA2180 Gene: ileS-1     GI: 47527474     BI number: GBAA2181     GOG: COG0060     Description: isoleucyl-tRNA synthetas   a a  g g  a ta        aa gc       t  a at        gc ta        gc ta        gc at        cg ta        gt cg       c  | g  a      t  |        t t  a      a  |      t  t g  |      t  |      c  a at       g  |       at at       g  |       ta ta       t  |       cg cg        gc        cg g  g       gc        cg t  g       gc        ta t  t       at        gc g  g       ta        cg cg       t  c       cg at        at        cg ta        at        at gt        gt        at                         ttttgtgtgctttaaaacattcaaaaggagtgattgtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................