                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggtaccgcg is shown in italic-bold style

aagtacatgatgcaaagatctacagagagcaatcggttgctggaaagattgcgataccgcatgatggaaagacacctgtgagtgttgctttgaacgtgat
aattagtaaaagcaaacggtacctaccgttatcaggactaagatggtcattatgacaatttgggtggtaccgcggaaaaatccgtccctatttatagggg
cggatttttgtattctttgaaagggggtgagtgaccgtggatgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgta
ATG

    aspS Gene: aspS-1     GI: 47527478     BI number: GBAA2186     GOG: COG0017     Description: aspartyl-tRNA synthetas   t t  a a  t cg ta gc g  a t  a a  | gt at        aa at       a  a       tt tg        at       t  a cg        gc        at a  g       gc        ta g  |       cg        cg g  |       gt        cg at       c  c       cg cg       c  c       tg tg       a  |       gc at       t  |       cg ta        gc        cg |  c       gt        ta |  c       ta        at tg        gt        at gc        gt        at cg        gt        at cg        ta        at                         gtattctttgaaagggggtgagtgaccgtggatgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-17.40 kcal/mol Antiterminator: Size=34 nt.     Delta G= -7.60 kcal/mol Anti-antiterminator:   Size=24 nt.     Delta G= -3.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: tgggtggtaccgcg is shown in italic-bold style aagtacatgatgcaaagatctacagagagcaatcggttgctggaaagattgcgataccgcatgatggaaagacacctgtgagtgttgctttgaacgtgat aattagtaaaagcaaacggtacctaccgttatcaggactaagatggtcattatgacaatttgggtggtaccgcggaaaaatccgtccctatttatagggg cggatttttgtattctttgaaagggggtgagtgaccgtggatgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgta ATG     aspS Gene: aspS-1     GI: 47527478     BI number: GBAA2186     GOG: COG0017     Description: aspartyl-tRNA synthetas            gg           t  g            tt            tg   g        ag a  a       at        tt a  t       ca       t  a tg       a  c       at cg       g  c       ta at       t  |       cg gc       a  |       cg |  a       tg        cg |  t       tc        tg |  t       ag        gc g  a       cg        cg at        ta        cg cg        ga        ta ta        ga        at                         ttttgtattctttgaaagggggtgagtgaccgtggatgatgacgatgacaacaacaataacgtaaataaatataaaattactggagggaaatgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................