                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-26.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.51 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

atagtcaaatgacatcctgaactcgcctaggagcagtaaggtagaacggaatcacattcttagtaaatcttaacggttaaccttcgatattaggtttgta
atcgaacgattactactaaggtggattcataatggaatcaataagggtggtaccgcgttaagcaaatggcttagcgtctctttatataaagagatgctga
gccattttttattttatagaaaaagaaatggagggtttatttggataggttcataaaatttatatatttatataaaagatttaattaggaggaaaataag
ATG

    GBAA2215 --- GBAA2216 Gene: GBAA2216     GI: 47527509     BI number: GBAA2216     GOG: COG0733     Description: sodium-dependent transporter, putative Gene: GBAA2217     GI: 47778019     BI number: GBAA2217     GOG: COG0596     Description: hydrolase, alpha/beta fold famil             a           a  t           a  g aa        cg t  t       gc a  g       at        ta cg        at       a  t ta        ta        ta ta        tg        ta at        gc        ta gc        cg        cg g  a       gt        ta ta       c  |       cg gt       c  |       ta g  a      a  |       gt a  a      t  |       cg a  g      g  |       gc tg       g  |       at cg       t  |       tg at        gc        ta tg        gt        cg cg        gc        gc at        at        gc ta        at        ta                         ttttttattttatagaaaaagaaatggagggtttatttggataggttcataaaatttatatatttatataaaagatttaattaggaggaaaataagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................