                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:44 nt.    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=43 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGC-TAAGTT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGCATAAATACGATACGAATAAGTTCCACGAAGAAACGAAACGTGCGTATAGCTT
AGTTTAAttagaaaaaccttaagatcgcatacggtcttaaggtttttttcataaataggacgtattattgatacaataatagtaaaaggatggac
aacatATG

   ك Gene: GBAA2252     GI: 47527549     BI number: GBAA2252     GOG: -------     Description: acetyltransferase, GNAT famil            ta           t  g CG       A  a A  A      A  a C  A       Ta CG        Ta TA        Ta TA        Gc G  A      |  c A  C      |  t       at A  G       At       c  a T  A       Ta        gc A  A       Ta        cg A  A       Cg        tg GC       G  a       at CG       A  t       gc AT       T  |       at TG       A  |       at A  |      T  |       ta GC        Gc        ta CG        Cg        cg AT        Gc        cg TA        Ta        at AT        Gt        at                         tttttcataaataggacgtattattgatacaataatagtaaaaggatggacaacatATG     ..................................................................................................................