Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:44 nt.    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=43 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGC-TAAGTT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGCATAAATACGATACGAATAAGTTCCACGAAGAAACGAAACGTGCGTATAGCTT
AGTTTAAttagaaaaaccttaagatcgcatacggtcttaaggtttttttcataaataggacgtattattgatacaataatagtaaaaggatggac
aacatATG

   ك


Gene: GBAA2252     GI: 47527549     BI number: GBAA2252     GOG: -------     Description: acetyltransferase, GNAT famil


           ta
          t  g
 CG       A  a
A  A      A  a
C  A       Ta
 CG        Ta
 TA        Ta
 TA        Gc
G  A      |  c
A  C      |  t       at
A  G       At       c  a
T  A       Ta        gc
A  A       Ta        cg
A  A       Cg        tg
 GC       G  a       at
 CG       A  t       gc
 AT       T  |       at
 TG       A  |       at
A  |      T  |       ta
 GC        Gc        ta
 CG        Cg        cg
 AT        Gc        cg
 TA        Ta        at
 AT        Gt        at
                        tttttcataaataggacgtattattgatacaataatagtaaaaggatggacaacatATG


    ..................................................................................................................