                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:47 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-27.60 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=42 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgccg-taaaag. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggaaccacg is shown in italic-bold style

gtgccgtgtaaacgacgttaccgtaaaagaagccattgcatgtttgtgatgggaatctgggtggaaccacgggtataagcacgctcgtccctattgtagg
gatgagtgtgctttttattatgaaatggagagatgaaaaATG

    thrS Gene: thrS-1     GI: 47527681     BI number: GBAA2388     GOG: COG0441     Description: threonyl-tRNA synthetas gt         g t  t      g  a at       t  a cg        gc g  t       gc t  g      |  a ta        gc at        tg         t cg        cg       t  g cg        tg        at |  g       at        ta g  a      |  a       cg a  a      |  t       cg at       |  a       cg gc       |  a       ta at       |  g       gt a  g      |  c       cg a  |      |  a       ta a  |      |  c       cg t  |      a  g       gt g  |       gc        cg cg        gt        at cg        gc        cg at        tg        gc tg        at        at tg        gc        at                         tttattatgaaatggagagatgaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0441 Threonyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................