                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaatttatacttcttaatgccataatacgaattacaaattaatacttatccagagaggtggagggaacggccctatgaaacctcagcaacccctatg
taaatgcataggaaggtgctaattccgcagagaacacgttgtgttttttggaagatgagaggattcttgaacgtgaaagaaaatgacctcttatgtaaga
ggtcattttttgttgtatagaaagggagtgtcgatgcataattcattttcaaaataaatatagagtaataaaagttgactattaagagaggggaattata
ATG

    GBAA2640 --- GBAA2641 --- GBAA2642 Gene: GBAA2640     GI: 47527932     BI number: GBAA2640     GOG: COG4720     Description: membrane protein, putative Gene: GBAA2641     GI: 47527933     BI number: GBAA2641     GOG: COG1122     Description: ABC transporter, ATP-binding protein Gene: GBAA2642     GI: 47778073     BI number: GBAA2642     GOG: COG0619     Description: cobalt transport protei   t g  t cg at cg at at gt at gt a  |       cg c  |      a  t gt       a  g cg       g  a cg        ta ta        ta ta        cg |  g       ta |  a       ta        tg a  t      |  a      a  t a  g      |  a       ta ta       |  t       ta cg       |  g       cg |  a      a  a       ta |  g       gc        cg |  g       gc        cg g  a       at        at t  t       gc        gc gt        at        ta gc        gt        at at        ta        at at        at        at                         tttgttgtatagaaagggagtgtcgatgcataattcattttcaaaataaatatagagtaataaaagttgactattaagagaggggaattataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4720 Predicted membrane protein ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here [P] COG0619 ABC-type cobalt transport system, permease component CbiQ and related transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................