                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.71 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

AAATAAATTATCTTAAttccatattatatatgcgctgaagaggaaacagtagtgcttatctcactgttaaagagagctgATGGTA
GGTGTGAATCAGTACAAAGATAAGCATGAATTACAGCCTTGGAGCATCTTTTCCGCCA
ACTTTTGGAGGGAAAGACGGTCAAATGATCGTTAAagaagaagagaggtagacaggtatttagtctacaactagggtggtaccgcgataaatatcgtccctactgagcgctcagtagggacttttttgtacaaaaaaatagtaaaggggcaagagaaATG

   ق --- hisC --- tyrA --- aroA Gene: aroF-2     GI: 47528251     BI number: GBAA2956     GOG: COG0082     Description: chorismate synthase Gene: hisC-2     GI: 50196937     BI number: GBAA2955     GOG: -------     Description: histidinol-phosphate aminotransferase Gene: tyrA     GI: 47778100     BI number: GBAA2954     GOG: COG0287     Description: prephenate dehydrogenase Gene: aroA     GI: 47778099     BI number: GBAA2953     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferas            aa           a  t            ta            at            gc            cg            gt        cg           c  |      g  c           c  |       at           a  |       gc           t  |       ta           g  |       cg           g  |       at           t  |       ta ta        gc        cg g  c       gc        cg gc        gc        cg tg        at        ta gc        ta        gc                         ttttttgtacaaaaaaatagtaaaggggcaagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0082 Chorismate synthase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................