Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:93 nt. Size=72 nt.     Delta G= -9.76 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-TACACT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAGAACTGCTTCGATCTGACTACACTGACGAGGAAATAACAGATGTCGTACGCG
ACATATGGAACAACCGAGAAGATCGTTATTCAGATGAACGGTTAAGTAATAGTAATAA
AAAAGCTATGCCTAAAATTGAAATGTCACATATCGGTGGTTAAtataaagttgacataaaagtgaaaa
atggaaggtgtacaagaattgtagattttctattttatagtaaaagtgatgattgatctctctgtaaaagATG

   ق --- moeA --- 2 --- moaE --- 2 --- moaD


Gene: GBAA3626     GI: 47528910     BI number: GBAA3626     GOG: -------     Description: hypothetical protein
Gene: GBAA3625     GI: 47528909     BI number: GBAA3625     GOG: COG2116     Description: formate transporter, putative
Gene: GBAA3624     GI: 47528908     BI number: GBAA3624     GOG: COG0476     Description: molybdopterin biosynthesis protein MoeB, putative
Gene: moeA-2     GI: 47528907     BI number: GBAA3623     GOG: COG0303     Description: molybdopterin biosynthesis protein MoeA
Gene: moaE-2     GI: 47528906     BI number: GBAA3622     GOG: COG0314     Description: molybdopterin converting factor, subunit 2
Gene: moaD-2     GI: 47778188     BI number: GBAA3621     GOG: COG1977     Description: molybdopterin converting factor, subunit


  a
t  a
a  a
 tg
 At
 At
 Tg
 Ta
 Gc
G  a
T  t
G  a
G  a
C  a
T  a
A  |
T  |
A  |
 Cg
 At
 Cg
 Ta
G  a
T  a
A  |        a
A  |      g  a
A  |       at
G  |       at
 Ta        cg
 Ta        at
 At        ta
A  g      g  g
A  g       ta
A  a       gt
 Ta        gt
 Cg        at
 Cg        at
 Gt        gc
 Tg        gt
 At        ta
            ttttatagtaaaagtgatgattgatctctctgtaaaagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG2116 Formate/nitrite family of transporters ... can be seen here
[H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here
[H] COG0303 Molybdopterin biosynthesis enzyme ... can be seen here
[H] COG0314 Molybdopterin converting factor, large subunit ... can be seen here
[H] COG1977 Molybdopterin converting factor, small subunit ... can be seen here

    ..................................................................................................................