                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-14.65 kcal/mol
Anti-antiterminator:   Size=80 nt.     Delta G=-25.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGATGTAAAAGTTACACAGGAACTTTACAACGGAGAGATAAAGTATCGATTAACTG
TACATCCTGAGGATGTTGGAAAAGTCATTGGAAAGCAAGGGAAAGTTGCGAAAGCAAT
TCGAATGCTCTTGTATTCAGTGGGACATCACAATAGTGAAAAAGTAACACTGGAAATT
CAATAAacgtaaaaagggcgaggagttattcctctcccttttttaacatttaaagagaagttgcatgttccatatgagaaatggggatgcttaatt
tatatagaaaccaggggtgacatactgtttATG

   ق --- sipS Gene: rimM     GI: 47529270     BI number: GBAA3980     GOG: COG0806     Description: 16S rRNA processing protein RimM Gene: trmD     GI: 47529269     BI number: GBAA3979     GOG: COG0336     Description: tRNA (guanine-N1)-methyltransferas            AT           A  A            CG            AT            CG AA        TA G  A      |  A CG       |  A GC       |  A TA       A  A TA        CG GT        AT AT       G  A |  C      G  A |  G       GC |  A       TA |  A       GC A  T       AT A  G       CG GC        TG GT        TA GC       |  A AT       |  A AT       |  T CG       |  T GT       |  C A  A      |  A A  |      |  A AT       |  T GT       |  A GC       |  A TA       |  a TG       |  c AT       |  g CG       |  t TG       |  a        t G  G      |  a      t  a A  A      |  a       gt A  C      |  a       at A  A      |  a       gc AT       |  g       gc GC       A  g       at |  A       Tg        gc GC        Gc       c  t TA        Tg        gc TA        Ta        gc GT        Cg        gc TA        Tg        at                         tttttaacatttaaagagaagttgcatgttccatatgagaaatggggatgcttaatttatatagaaaccaggggtgacatactgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0806 RimM protein, required for 16S rRNA processing ... can be seen here [J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here     ..................................................................................................................