                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-28.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attaagaaaaacgaagatagggataagtacctttttcataccttatatagcgaactgaggatggtgtaagctcaggataaggagataatgggaatatcac
cctggagttccgcgctgaacaaatagagtaagcgtaggcgtatattcgcgttaagaatataaagagggttgtatacatacgtataggatctactagggtg
gtaccgcgggagactttctcgtccctttttgggatgagaaagtctcttttttattccgttttttaggtctttcttttatacatgtaaggaggaattgagc
ATG

    ileS Gene: ileS-2     GI: 47529327     BI number: GBAA4034     GOG: COG0060     Description: isoleucyl-tRNA synthetas   t t  t t  t cg cg         c cg       t  t ta        gc gt        at cg        at ta        at cg        gt ta        at ta        gt ta        ta cg        at at        gt gc        gc at        gc gc        tg             ttttttaggtctttcttttatacatgtaaggaggaattgagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-28.10 kcal/mol Antiterminator: Size=32 nt.     Delta G= -8.41 kcal/mol Anti-antiterminator:   Size=8 nt.     Delta G= -1.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggtaccgcg is shown in italic-bold style attaagaaaaacgaagatagggataagtacctttttcataccttatatagcgaactgaggatggtgtaagctcaggataaggagataatgggaatatcac cctggagttccgcgctgaacaaatagagtaagcgtaggcgtatattcgcgttaagaatataaagagggttgtatacatacgtataggatctactagggtg gtaccgcgggagactttctcgtccctttttgggatgagaaagtctcttttttattccgttttttaggtctttcttttatacatgtaaggaggaattgagc ATG     ileS Gene: ileS-2     GI: 47529327     BI number: GBAA4034     GOG: COG0060     Description: isoleucyl-tRNA synthetas             c           a  t        t            gt       t  t            at       t  t            gc        cg            gt        cg            gc        cg            cg        ta            gt        gt           c  |       cg           c  |       ta           a  |       cg           t  |       ta           g  |       ta           g  |       ta           t  |       cg ag        gc        at g  a       gc        gc gc        gc        at gt        at        gc                         ttttttattccgttttttaggtctttcttttatacatgtaaggaggaattgagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................