Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:201 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.00 kcal/mol
Antiterminator:    Distance from promoter:181 nt. Size=29 nt.     Delta G=-15.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-taaatt. It has a score value of 79.65 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttttgcatttgtgcgtgctaaatttattaaaaaattaacaaacattgttaaaaggggaacgcatttccttttagctacataaataaaataataaa
gacaactcttattgagagcggtggagggaaaggccctgtgaaacccggcaaccttcaaacgaaatgtttgaaacggtgctaatacctgcaaaacgaatgt
tttgcataataagaggaggaacaattatgttcccctcttcaaagtgaagagggggtttttatattgatagaaatgagggagatttGTG

    metH --- 2 --- murG


Gene: GBAA4479     GI: 47529773     BI number: GBAA4479     GOG: COG0646,COG0685     Description: homocysteine S-methyltransferase domain protein/methylenetetrahydrofolate reductase family protein
Gene: metH     GI: 47778299     BI number: GBAA4478     GOG: COG0646,COG1410     Description: 5-methyltetrahydrofolate--homocysteine methyltransferase
Gene: murG-2     GI: 47529771     BI number: GBAA4477     GOG: -------     Description: UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferas


 tt
a  a
 at         a
 cg       a  g
 at       a  t
 at        cg
 gc        ta
 gc        ta
a  |       cg
 gc        ta
 gc        cg
 at        cg
 gc        cg
 at        cg
 at        tg
            tttttatattgatagaaatgagggagatttGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0646 Methionine synthase I (cobalamin-dependent), methyltransferase domain ... can be seen here
[E] COG0685 5,10-methylenetetrahydrofolate reductase ... can be seen here
[E] COG0646 Methionine synthase I (cobalamin-dependent), methyltransferase domain ... can be seen here
[E] COG1410 Methionine synthase I, cobalamin-binding domain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................