                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:206 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-21.00 kcal/mol
Antiterminator:    Distance from promoter:188 nt. Size=31 nt.     Delta G= -8.61 kcal/mol
Anti-antiterminator:    Distance from promoter:159 nt.    Size=49 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gagaat-tataat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtatcgcg is shown in italic-bold style

gagaattctattatatttagtcatataatacattaaatcaatgacggaacaagtacgttacagtccatttatagagagaagcttccatatggctgaaaga
agctttaaatgaagggtaacagaaagctaatcctgagagcagctaatcactgccgtcttgccacgttacggcaccatgaggtgatgaattgattcgtata
gcaatcaattcataattagggtggtatcgcgagttaactctcgtcccttttataggggcgggagttttttatatttaaggaggaaaatacaATG

    alaS Gene: alaS     GI: 47529915     BI number: GBAA4616     GOG: COG0013     Description: alanyl-tRNA synthetas   a c  t ta ta at at |  a cg        aa tg       t  c a  g      t  t at        gc         t cg        at       t  a g  g       gc       t  t at        cg        ta ta        gt        cg at       c  |       cg |  c      t  |       cg tg       a  |       tg gc       t  |       gc cg       g  |       cg ta       g  |       tg tg       t  |       cg at        gc        ta gt        gc        cg ta        gc        at ta        at        at                         ttttatatttaaggaggaaaatacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0013 Alanyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................