                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:178 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-22.60 kcal/mol
Antiterminator:    Distance from promoter:155 nt. Size=36 nt.     Delta G= -7.71 kcal/mol
Anti-antiterminator:    Distance from promoter:121 nt.    Size=43 nt.     Delta G= -8.86 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tacaca. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaccacg is shown in italic-bold style

ttgatagagaagagtaaatgagatacacatggaaagagaagaaatgtcttaggctgaaaacatttctacatggtgactgattgaatgacactctagaggt
ttcaacttgaacggcatatacgcttagtagggatgaacgcacatttaagcgttattaaaaaagtggaagcatacgtgcttcaattagggtggcaccacgg
gtataatactctcgtccctactgttcaaacagtagaggcgggagtttttttatttttattaagattaaaacaatttgaggaggaactgaatATG

   ق --- aspS Gene: hisS-2     GI: 47529931     BI number: GBAA4633     GOG: COG0124     Description: histidyl-tRNA synthetase Gene: aspS-2     GI: 47529930     BI number: GBAA4632     GOG: COG0173     Description: aspartyl-tRNA synthetas ac t  g        a at       a  t cg       t  a gc       a  c       ca at       t  t      t  a at        gc        ta gc        gt        gc g  a       gc        ta t  a       cg        cg g  t       at        at a  t      c  |       ta a  a      c  |       cg a  g      a  |      c  a a  |      c  |       cg a  |      g  |       tg a  |      g  |       gc tg       t  |       cg tg        gc        tg at        gc        cg tg        gc        ta tg        at        cg gc        ta        at                         ttttttatttttattaagattaaaacaatttgaggaggaactgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0124 Histidyl-tRNA synthetase ... can be seen here [J] COG0173 Aspartyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................