                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.91 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -1.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccacg is shown in italic-bold style

cttcctaatacggaaagacgaacttaccacctctaaacttcaagagtgaactgcatgcataatgcattgtaattcttggcggataaaaccgttatcaatt
tacacgagctataaaatgagcttatttcgttataaattcattttattagaataagggtggaaccacgatttcaacactcgtccctttgttagggacgggt
gttttttgcgttcttttacggggaagtatgcttgaaagaggatatatgacggattttaattcagaatattttgttaaattaaattaggaggttagtagaa
ATG

    brnQ Gene: brnQ-6     GI: 47530088     BI number: GBAA4790     GOG: COG1114     Description: branched-chain amino acid transport system II carrier protei             a           c  a           t  c           t  a           t  c            at            gc         g            cg       t  t            at       t  t   g       c  |       ta g  a      c  |       cg t  a      a  |       cg gc       a  |       cg gc       g  |       ta g  a      g  |       gc a  c      t  |       cg a  g       gc        tg ta        gc        cg at        gc        at at        at        cg gt        at        at                         tttttgcgttcttttacggggaagtatgcttgaaagaggatatatgacggattttaattcagaatattttgttaaattaaattaggaggttagtagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................